Workflow Type: Galaxy
Frozen
Complete RNA-Seq analysis for paired-end data: Processes raw FASTQ data through adapter and bad quality removal (fastp), alignment with STAR using ENCODE parameters, gene quantification via multiple methods (STAR and featureCounts), and expression calculation (FPKM with Cufflinks/StringTie, normalized coverage with bedtools). Produces count tables, normalized expression values, and genomic coverage tracks. Supports stranded and unstranded libraries, generating both HTSeq-compatible counts and normalized measures for downstream analysis.
Inputs
| ID | Name | Description | Type |
|---|---|---|---|
| Collection paired FASTQ files | Collection paired FASTQ files | Should be a list of paired-end RNA-seq fastqs |
|
| Compute Cufflinks FPKM | Compute Cufflinks FPKM | Whether FPKM values should be computed with Cufflinks |
|
| Compute StringTie FPKM | Compute StringTie FPKM | Whether FPKM values should be computed with StringTie |
|
| Forward adapter | Forward adapter | This is optional. Fastp will use overlapping. If you want to specify, for Nextera use: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC, for TruSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC |
|
| GTF file of annotation | GTF file of annotation | GTF compatible with the reference genome. Mind the UCSC/Ensembl differences in chromosome naming. |
|
| GTF with regions to exclude from FPKM normalization with Cufflinks | GTF with regions to exclude from FPKM normalization with Cufflinks | It could be a GTF with for example one entry for the chrM forward and one entry for the chrM reverse |
|
| Generate additional QC reports | Generate additional QC reports | Whether to compute additional QC like Falco, gene body coverage etc... |
|
| Reference genome | Reference genome | Select the reference genome |
|
| Reverse adapter | Reverse adapter | This is optional. Fastp will use overlapping. If you want to specify, for Nextera use: CTGTCTCTTATACACATCTGACGCTGCCGACGA, for TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
|
| Strandedness | Strandedness | For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence |
|
| Use featureCounts for generating count tables | Use featureCounts for generating count tables | Use featureCounts tool instead of RNA STAR? |
|
Steps
| ID | Name | Description |
|---|---|---|
| 11 | Flatten collection | __FLATTEN__ |
| 12 | remove adapters + bad quality bases | toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/1.3.6+galaxy0 |
| 13 | No extra QC | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 14 | get reference_genome as text parameter | toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1 |
| 15 | Get featureCounts strandedness parameter | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 16 | Get cufflinks strandedness parameter | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 17 | Get Stringtie strandedness parameter | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 18 | STAR: map and count and coverage splitted | toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.11b+galaxy1 |
| 19 | Generate Unstranded Coverage | n/a |
| 20 | Generate Stranded Coverage | n/a |
| 21 | featureCounts | toolshed.g2.bx.psu.edu/repos/iuc/featurecounts/featurecounts/2.1.1+galaxy1 |
| 22 | Compute FPKM with StringTie | toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/3.0.3+galaxy1 |
| 23 | Compute FPKM with cufflinks | toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.4 |
| 24 | More QC | n/a |
| 25 | Process Count files | n/a |
| 26 | MultiQC without extra QC | toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.35+galaxy1 |
| 27 | MultiQC with extra QC | toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.35+galaxy1 |
| 28 | MultiQC HTML report | toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0 |
| 29 | MultiQC stats | toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0 |
Outputs
| ID | Name | Description | Type |
|---|---|---|---|
| Mapped Reads | Mapped Reads | n/a |
|
| Unstranded Coverage | Unstranded Coverage | n/a |
|
| Stranded Coverage | Stranded Coverage | n/a |
|
| Gene Abundance Estimates from StringTie | Gene Abundance Estimates from StringTie | n/a |
|
| Genes Expression from Cufflinks | Genes Expression from Cufflinks | n/a |
|
| Transcripts Expression from Cufflinks | Transcripts Expression from Cufflinks | n/a |
|
| Counts Table | Counts Table | n/a |
|
| MultiQC HTML report | MultiQC HTML report | n/a |
|
| MultiQC stats | MultiQC stats | n/a |
|
Version History
v0.1 (earliest) Created 25th Oct 2022 at 03:01 by WorkflowHub Bot
Updated to v0.1
Frozen
v0.1
4c67dcd
Creators and SubmitterCreator
Additional credit
Lucille Delisle
Submitter
License
Activity
Views: 19062 Downloads: 75205 Runs: 2
Created: 25th Oct 2022 at 03:01
Last updated: 17th Jan 2023 at 03:01
Annotated Properties
Scientific disciplines
Computer Science
Tags
AttributionsNone
View on GitHub
Run on Galaxy